Review





Similar Products

rabbit polyclonal anti human col4a1  (Absolute Biotech Inc)
86
Absolute Biotech Inc rabbit polyclonal anti human col4a1
Rabbit Polyclonal Anti Human Col4a1, supplied by Absolute Biotech Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/col4a1/pmc13052084-171-3-8?v=Absolute+Biotech+Inc
Average 86 stars, based on 1 article reviews
rabbit polyclonal anti human col4a1 - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
col4a1  (Cell Signaling Technology Inc)
94
Cell Signaling Technology Inc col4a1
Col4a1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/col4a1/pm41906758-23-18-36?v=Cell+Signaling+Technology+Inc
Average 94 stars, based on 1 article reviews
col4a1 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier
collagen type iv alpha 1 col4a1 invitrogen  (Thermo Fisher)
99
Thermo Fisher collagen type iv alpha 1 col4a1 invitrogen
Collagen Type Iv Alpha 1 Col4a1 Invitrogen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/col4a1/pm41887219-877-45-51?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
collagen type iv alpha 1 col4a1 invitrogen - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier
col4a1 fw gacccccgggagaaataggttt rv acctttgagccgcaagtcgaa  (Merck & Co)
86
Merck & Co col4a1 fw gacccccgggagaaataggttt rv acctttgagccgcaagtcgaa
Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, <t>COL4A1,</t> and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.
Col4a1 Fw Gacccccgggagaaataggttt Rv Acctttgagccgcaagtcgaa, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/col4a1/pmc12996707-55-0-4?v=Merck+%26+Co
Average 86 stars, based on 1 article reviews
col4a1 fw gacccccgggagaaataggttt rv acctttgagccgcaagtcgaa - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier
collagen iv antibody  (Boster Bio)
91
Boster Bio collagen iv antibody
Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, <t>COL4A1,</t> and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.
Collagen Iv Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/col4a1/pmc13104450-112-52-57?v=Boster+Bio
Average 91 stars, based on 1 article reviews
collagen iv antibody - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier
polyclonal goat anti col4a1 2  (SouthernBiotech)
94
SouthernBiotech polyclonal goat anti col4a1 2
Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, <t>COL4A1,</t> and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.
Polyclonal Goat Anti Col4a1 2, supplied by SouthernBiotech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/col4a1/pm41712384-731-74-77?v=SouthernBiotech
Average 94 stars, based on 1 article reviews
polyclonal goat anti col4a1 2 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

Image Search Results


Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.

Journal: iScience

Article Title: Electromagnetic exposure changes human Schwann cell motility and transcriptomic profile of hearing-loss-related genes

doi: 10.1016/j.isci.2026.115130

Figure Lengend Snippet: Validation of coding and non-coding DEGs (A) Expression of some modified coding DEGs ( RPLP1, SPTAN1, ARPC2, COL4A1, and LAMC1 ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001. One-way ANOVA using Sidak’s post-test. (B) Expression of 2 modified non-coding RNAs ( VIM-AS1 and CYTOR ) by real-time qRT-PCR. Data are expressed as 2 −ΔΔCt using control samples as reference ( n = 3 for control and EMF, respectively). ∗ p < 0.05. One-way ANOVA using Sidak’s post.

Article Snippet: COL4A1 Fw:GACCCCCGGGAGAAATAGGTTT Rv:ACCTTTGAGCCGCAAGTCGAA , Merck Life Science, Milan, Italy , –.

Techniques: Biomarker Discovery, Expressing, Modification, Quantitative RT-PCR, Control